Interested in working on the development of this resource? Apply here.

17:3552197 ATATTACTATCCTTGAGCTCCC / A


Filter Status
VQSRTrancheINDEL99.50to99.90
dbSNP
rs113994204
Allele Frequency
2.472e-05
Filtering AF
3e-05 (Latino)
Allele Count
3 / 121374
UCSC
17-3552197-ATATTACTATCCTTGAGCTCCC-A
ClinVar
Click to search for variant in Clinvar
Note: Plot may include low-quality genotypes that were excluded from allele counts in the table above

Note: These are site-level quality metrics: they may be unpredictable for multi-allelic sites.

Annotations

This variant falls on 12 transcripts in 1 genes:

Note: This list may not include additional transcripts in the same gene that the variant does not overlap.
Population Frequencies
Population Allele Count Allele Number Number of Homozygotes Allele Frequency
European (Non-Finnish) 1 66726 0 1.499e-05
East Asian 0 8652 0 0
Other 0 906 0 0
African 0 10392 0 0
Latino 2 11574 0 0.0001728
South Asian 0 16510 0 0
European (Finnish) 0 6614 0 0
Total 3 121374 0 2.472e-05

Read Data

This interactive IGV.js visualization shows reads that went into calling this variant.
Note: These are reassembled reads produced by GATK HaplotypeCaller --bamOutput so they accurately represent what HaplotypeCaller was seeing when it called this variant.